Atheism/Lets talk about GOD!

[N.O.R.F]

Originally posted by G G:

RAMSAADE WROTE:

 

"Sorry to burst your bubble but science relies on objective and verifiable facts not on cartoons and drawings. The fossil record is REAL and deadly for Creationism."

 

I guess you just didn't read my post well. What "objective and verifiable facts" have you got on the skin colour of dinosaurs? Or the shape of the iris? That's what I meant.

Oh and by the way, about cartoons and drawings: I applaud evolutionary theorists for their excellent and groundbreaking scientific visualization abilities, as they managed to sketch a whole pre-human and his family (complete with skin and hair - in colour) from 2 teeth. Which then unfortunately had to belong to a stopid pig. This wasn't of course forgery, this was a serious misunderstanding (I'm seriously not being sarcastic). If the teeth had been human, it would have made all the difference.

 

"Creationists are fond of employing red herrings and straw man arguments. I guess when you can't handle the evidence and powerful arguments for Evolution you try your luck at anything."

 

I know, the evidence is just

overwhelming

.

Wait, what evidence? (Btw I really don't like being called a creationist)

 

"For the same reason Theists fabricate bogus evidences for their believes."

 

I agree, evoscientists are as reliable as the writers of the Bible. Are they related?? That's the new hot question, my friend!

 

"Again, why would I? You know I reject the whole notion of prophet-hood. Mohammed was just 7th century arab leader albeit extraordinary one. His conduct can only be judged by the moral standards of his time not ours. Since I'm not a person calling for people to emulate Mohammed in the 21st century, I don't need to find faults with his actions and believes; it's actually you who has to defend him. "

 

Fair enough.

 

"Muslims of his time were busy dealing in slavery, specially black Negros like yourself. "

 

Muslims can't be slaves, soz bruv.

 

"Since that is NOT what Evolution theory postulates, let me know when you're interested in discussing the facts"

 

I think I already asked you; please explain/clarify to me what evolutionary theory is. See, I even asked you nicely

 

"I'm not gonna respond to this but let it hang there. It will come in handy later in showing us GG's entire understanding of genetics and mutations is cartoon-ish as it is gleaned from cartoons."

 

Thanks! I agree with you, that

is

pretty cartoonish! Thank you for agreeing with me. Unfortunately that was actually what De Vries suggested in early 20th century.

And he was the developer of mutation theory of evolution. :'( That's why my knowledge of genetics is so cartoonish and naive. I blame him, it was the swieetie man. Fooking Dutch and his prawnmen!

 

Nonsense. Whales have vestigial hind limbs that are leftovers from when they walked on land.

 

That's what evolutionists think. I just read today in the Guardian that T-rex has a tiny older brother, and it has just been found:

 

"The discovery overturns scientists' thinking about how Tyrannosaurus rex evolved. Many of the most striking features of the beast, such as its puny forearms, were thought to be a trade-off during the evolution of its enormous size, but Raptorex shows these features had already evolved more than 60m years earlier."

 

Scientists sure seem to think a lot.

 

"Here is non-exclusive list: Eoraptor, Herrerasaurus, Ceratosaurus, Allosaurus, Compsognathus, Sinosauropteryx, Protarchaeopteryx, Caudipteryx, Velociraptor, Sinovenator, Beipiaosaurus, Sinornithosaurus, Microraptor, Archaeopteryx, Rahonavis, Confuciusornis (my favorite), Sinornis, Patagopteryx, Hesperornis, Apsaravis, Ichthyornis, and Columba."

 

You know what, I actually googled that list in that exact order and guess what came up? A thread called "Finally, tangible PROOF of MACRO-EVOLUTION". Let me guess your search words: "TANGIBLE PROOF OF MACRO-EVOLUTION, HELP!"

Now what did you say about copy&paste, you old hypocrite? Shame on you. I doubted you knew anything, because even in spite of your eloquent use of fancy words, you dangerously confuse things and are not even familiar with the basics.

 

"There were different kind of species of Australopithecus, which one are you referring. Lets take, for arguments sake, Australopithecus Afarensis. This species was clearly an intermediate between apes and humans. For instance, its brain was about the size of chimpanzee but it was bipedal and had anatomical features resembling more closely humans as opposed to apes. Furthermore, its teeth looked more human than apes."

 

This is exactly what I mean with "confusing things". Australopithecus (both aferensis and africanus) is (supposedly) the forefather of modern chimpanzees. The fact that you say they resemble more humans than apes just sealed it for me.

 

"And the date of the fossils predate fossils for modern humans"

 

And this is your explanation? Because they came earlier, they must be their ancestors?

Let me ask you something in that case: who came first the floresiensis or the neanderthal? And now: which resembles more the modern human?

 

And by the way, how does one get the date of fossils?

 

Yes, they did not have bones since most animals are insects. This is why most fossils consist of hard stuff like bones, teeth, claws. We rarely find skin or tissue. The species that leave best and most fossils are those that: lived for long time, had hard body parts, were numerous and lived over large geographical area. Plant fossils are discovered, far less than animals, precisely because they're more ubiquitous and live in many different ecosystems

 

Please read what you wrote. "They didn't have bones since most animals were insects"? That is utter nonesense. The reason fossils are discovered rarely is because their remains decompose. It has nothing to do "bodies made of hard stuff" but everything to do with the body being covered with sediment in order to preserve.

 

"This is what I meant when earlier I said GG's conception of Genetics and mutations is cartoon-ish."

 

Yay! I know, right?!

 

"Mutations are merely mistakes from copying the genetic material during cell division (reproductive cells). These mutations add to the genetic diversity by adding new mutations on top of inherited mutations."

 

Dear God. Delete this post before you start regretting it. It's really embarrassing.

You haven't got the faintest of idea of what you're talking about. it's not even funny. We don't all carry mutant genes, if we did we'd be facking retards. (No offense to those who have inherited diseases)

 

"Perhaps GG should stop watching X-Men and start reading High School biology textbook. "

 

Perhaps you should cut the pseudo-intellectual crap, and have a look at that biology book. Mutations add to the genetic diversity... on top of inherited mutations... Lol.

 

"Second, Archeopteryx were their own species (as are all species) but they had features that were not completely dinosaur or completely bird, hence their status as intermediate species."

 

So a group of guys had a look at this bird that looked funny, and in their all-powerful wisdom, they declared it an intermediate? Yeah, sure, sounds good by me.

 

"They're not? Please, enlighten us. For example, tell us where we look for those mutations?"

 

Why genetic make up and mutation are not the same thing:

 

Mutations are changes in the DNA sequence of a cell's genome and are caused by radiation, viruses, transposons and mutagenic chemicals, as well as errors that occur during meiosis or DNA replication.

Due to the damaging effects that mutations can have on cells, organisms have evolved mechanisms such as DNA repair to remove mutations.

 

This is from Wikipedia. You could have just typed 'mutation' and saved me the trouble and yourself the embarrassment.

 

You're clueless, aren't you"

 

I am.

 

"There are still single celled organisms."

 

And where did they come from? Or have they always been, and we've solved the mystery of life, and these single celled organisms are the origin of all life, our forefathers?

 

"Yes, like in the X-Men cartoons. "

 

Totally. I like the films better though.

 

"Because omniscient, omnipotent creator knows the outcome before the test on earth. Before God creates you, He already knows your destiny otherwise he's not omniscient. He chose, out of His free will, to create you knowing ahead of time where you will end up."

 

Of course He does. It's no secret, you know?

 

"Thus, the test on earth is meaningless and free will is an illusion."

 

Life on Earth (material pursuits etc) is meaningless and ultimately an illusion. The test however is real. The realness of free will can be seen in our discussion: you don't believe in God, I do. Because God has created you so that you will never be able to predict tomorrow; knowing your future is impossible for you. Therefore free will is real for you and not for Him. Just like this world is the reality for you and not for Him.

A comprehensive rebuttle tinged with humour and sarcasm

[Cara.]

OK GG, I think I see where the confusion stems from. When a biologist says "mutation", they don't mean you suddenly have extra toes or no liver or you can shoot spider webs out of your wrists. A mutation is ANY change in your genetic make-up. To say that "DNA changes, and sometimes these changes result in mutation" is sort of like saying "Birds fly, and sometimes this flying results in wings". Birds fly because they have wings, DNA changes because there's a mutation.

 

Let's look at a simple example. You have a gene for making an enzyme called SOL hydrogenase. This is an important enzyme that lets you click on and reply to topics on SOL. The enzyme is active in the finger tips and the cornea of the eyes. The gene for SOL hydrogenase is in chromosome 13. You have two chromosome 13's, one you inherited from your father and one you inherited from your father. Now the SOL hydrogenase gene is very short, only 20 base pairs of DNA:

 

AAAAGGGTTTCGCGAAAAAA AAA

 

It's also very repetitive

 

Remember it's double-stranded DNA, so the complementary sequence is TTTTCCCAAAGCGCTTTTTT TT, but for simplicity's sake let's focus on the one strand. Now almost all mammalian genes have introns, which are short sequence within a gene that don't code for a protein, they basically get snipped out during mRNA processing. The SOL hydrogenase gene has 3 intronic bases, which are in small case:

 

AAAAGGGTTtcgCGAAAAAAAAA

 

If there was a "mutation" in the intronic sequence such that your gene now reads

 

AAAAGGGTTccgCGAAAAAAAAA

 

What's the outcome for you? Almost certainly none, because the region mutated is an intron, so you still make a functional SOL hydrogenase.

 

Now what if the mutation was in the important exonic sequence, so that you now have:

 

AAAAGGGTTtcgCGAAAACAAAA

 

 

Does this mean you can no longer post on SOL? No, not really. Because you have two copies of the gene (one from dad, one from mom), the non-mutated gene can pick up the slack. Or maybe the mutation happened in your pancreas, where you don't even need the gene. Or really, it only happened in one cell, so only that cell will be not making SOL hydrogenase. The bottom line is that even these "changes in the genetic make-up" are called mutations because that's what they are.

 

Alright. Final bit of reminder. Remember at conception you start out as a single fertilized cell which then divides many many times to make a fully developed fetus, and then many more cell divisions later you're a full grown adult. As an adult you have approximately 50 trillion cells in your body (50000000000000) so obviously there has been many many cell divisions over that time. If mutations happen even 1 in 10,000 DNA bases, and you have 3 billion bases of DNA per cell, and 50 trillion cells per person, you are talking about a fair number of mutations over time. Whether it's a critical mutation depends on when in happens (early on as the fetus is generating the first cell of an organ, or later when you have million of other cells per organ), where it happens (introns vs exons, in the right organ or in an irrelevant organ, etc) and whether you have another good copy of the gene that will hopefully pick up the slack.

 

quote:

---

What is the process by which bacteria and viruses become resistant to antibiotics/antivira ls?

This is irrelevant. Mutation is rare - an exception and not the rule.

I don't follow how that's irrelevant. Antibiotic resistance is a classic example of a beneficial mutation (well, beneficial for the bacterium, not for us), and here you seem to be arguing that mutations do not happen and if they do they signify that something has gone terribly wrong. Could you explain how antibiotic resistance fits in your paradigm?

[Mr. Somalia]

Originally posted by Arac:

The gene for SOL hydrogenase is in chromosome 13. You have two chromosome 13's, one you inherited from your father and one you inherited from your father.

Saaxiib, you whole argument is flawed because your premise was flawed to begin with. This lady you are engaging was not sired by 2 fathers...

 

Arac, you have no evidence to prove that God does not exist. So move along with these cheap drivel, mate.

[Cara.]

^

 

Prove that GG doesn't have two fathers. Otherwise the belief that she has two fathers is as valid as the belief that she has a mother and a father.

[Mr. Somalia]

^^^

Why don't you do just a little bit of work yourself, Arac. Your idea of proof-- that she has 2 fathers-- appears to be a sentence with few words and no proof. There are a lot of people like you who cannot prove their simple careless statements. I'm not surprised sxb.

[Somali09]

Originally posted by Arac:

^

 

Prove that GG doesn't have two fathers. Otherwise the belief that she has two fathers is as valid as the belief that she has a mother and a father.

Its a valid point - lets see how theists explain it.

To "Mr Somalia" - isnt that what the Quran is, just sentences with words and no proof!!!

[Somali09]

Its comical how religious people always assume atheists to be a "waste" or lack any purpose or direction in life just because we dont believe in an imaginary being in the sky.

 

I dont have to keep my lack of belief to myself, why should I?

You are free to express your beliefs (privately & publicly) and opinions derived from those beliefs and I believe I have the same rights to do so. I dont go around preaching people to give up their religion, I only encourage them to start thinking for themselves. I think one of the most saddest images (to me child abuse) is millions of children of muslim parents being asked to memorise the quran before they are taught their own languages and history let alone given the chance to develop reasoning ability.

 

To "Mr Somalia"

It is true that science does not know everything about everything in the world. But that is one of the beautiful aspects of science, its hunger to discover the unknown. Scientists are making extraordinary discoveries everyday about ourselves, the world, galaxy, universe etc. While religion aims to hold back progress. It attempts to explain everything so we should not bother!

 

It seems to me that you are requesting proof that god himself does not exist, NOT the words contained in the Quran. Isnt the book his supposed words??? And if science can provide explanations (with evidence) to a range of things....say evolution or big bang, doesnt that discredit the quran and ultimately allah?

 

Putting aside the Quran, there is nothing that ANYONE can provide you to prove that God (the actual being) does not exist. Its a result of imagination. I can say there is an invisible tea pot revolving around earth, contrary to science. What proof would you need to disapprove my claim??

 

God does not exist because science has shown that his supposed words in holy books to be false!!!

 

Religious people have resorted to looking for God in the holes of science. For example evolution, we do not have the fossilized remains of every single animal to have lived but we have enough to support the theory. Same with our understanding of the origin of life and the universe. But when there is any holes in the current knowledge, you automatically shout....there you see! I told you its God!.

And as science keeps filling its holes by adding new knowledge, you keep moving this imaginary being to new holes. You will one day run out of holes to hid him - what would you do? Will you become a "waste" as us atheists

[Johnny B]

^ Norf,

I sense a slight yet severe misconception from your part,regarding Agnosticism and Atheism,so for fairness sake,let me answer from the Atheistic point of view, lest you must have it both ways to satisfy a subconscious need, will you?!

 

N: Are you an Agnostic or an Atheist?

J: Firstly,being one doesn't preclude being the other. I'm Agnostic regarding many things,and Atheistic regarding many Gods.

My Agnosticism has to do with knowledge, my Atheism has to do with Gods as defined by the Believers,where the referent of the positive claimant is of an uncommon or immaterial in nature.

 

N:Isn't Atheism? the doctrine or the Belief that there is no God?

J: Not at all, Atheism is simply the lack of Belief in Gods, Just the opposite of Theism ,namely,the Belief in Gods.

 

N: What you're doing is saying I believe in X because Y can't be proven to me.

J: I'm not sure if i quite follow the relationship of X and Y, could you be more specific?

All Atheists are saying is we lack belief in X, because X ( and not Y ) is not insofar,

neither coherently/cogently presented nor proven beyond reasonable doubt.

 

N: You can't have your cake and eat it.

J: What cake?, who made it? .. ( just kidding ).

If i read you right and by this you mean 'You can't lack belief in Gods whose existence you can't disprove'

then , you're just recasting the negative proof fallacy.

There is no need to disprove all that doesen't really exist, some 'god(s)' are among them, that they don't exist is already the default position.

 

 

Mr.somalia,

 

You as a Muslim,don't believe in all the possible Gods out there,except one.

Now, given that no god's existence can absolutely be disproved,how come you do not worship them all?.

 

 

 

Give it another shot!

 

I stand corrected if ceding legitimacy to such grotesque piece of reasoning,

"Did we really evolve from monkeys as those textbooks tell "

can as poetic as it may seem be an entry-point of a sincere scientific debate.

 

Obviously the thread cries for positive contribution, preferably something about God.

[Raamsade]

Originally posted by Mr. Somalia:

Nice to hear from you,

Raamsade

. You have broken your silence. Why? I do not scare you, do I? I certainly hope I don't.

I'm a busy man; I post here whenever I get spare time.

 

 

Originally posted by Mr. Somalia:

Honestly sxb, I haven't heard one person asking you to prove God does not exist.

Then you must be experiencing the onset of amnesia or having a full-blown one. You said this earlier in this thread:

 

"To Johny B:

 

Got any proof that the Al-mighty and glorious Allah doesn't exist?"

 

No one can prove what doesn't exist; it's logically absurd question to ask.

 

The burden of proof always lies with the affirmative position. If you say God exists, the onus is on you to provide evidence for His existence. It's elementary logic taught to us, well some of us at least, as early as grade school.

 

 

Originally posted by Mr. Somalia:

I figured if certain people of atheistic persuasions such as yourself, could bandy about the simple statement that "no one can prove the existence of God,"

Note that proof doesn't exist in the real world, only evidence and reason. That said, when an atheist makes the above declaration (using "prove" in the vernacular sense), he/she is not making a universal claim. In other words, they're not saying God in general doesn't exist but the God of Christianity or Allah or Yahwe or Thor doesn't exist.

 

A universal rejection of God is superfluous since no one defined such God in the first place. But the God of many religions are defined and given attributes. Since no empirical evidence is presented for such God's existence, we can use logic. And logic tells us that any entity with contradictory attributes/definitio ns -- such as omnipotent and omniscience -- can't logically exist.

 

This is how an Atheist can say the God of religion X or Y doesn't exist. But the same statement can't be extended to a universally to a God that no one has yet defined. As the old dictum goes "absence of evidence is not evidence of absence."

 

 

 

Originally posted by Mr. Somalia:

then surely, they should be able to prove that the following simple sentence is false: To date no one has produced any evidence that proves God does not exist. Methinks, no one has succeeded so far, because they just do not know and cannot prove it.

Then, you must believe in Thor, Waaq, Isis, Mithra etc... right? After all, no one has to date produced any evidence that proves all these Gods don't exist.

[Raamsade]

Originally posted by G G:

What "objective and verifiable facts" have you got on the skin colour of dinosaurs? Or the shape of the iris?

We have dinosaur skin fossils but their color and the color of eyes are entirely speculative at this stage.

 

But this is, once again, another straw man argument from creationists (and yes, you ARE a creationist). The skin color of dinosaurs is completely irrelevant to whether evolution occurred or not. Our current knowledge of dinosaurs comes from the fossil record not what scientists speculate. Deal with the evidence for Evolution!

 

 

Originally posted by G G:

Oh and by the way, about cartoons and drawings: I applaud evolutionary theorists for their excellent and groundbreaking scientific visualization abilities,

Once more, we have our dear GG showcasing her aversion for facts and attacking imaginary positions no one holds.

 

The reason Evolutionary Theory displaced Creationism about 150 years ago and became the central organizing principal for all sciences since is based on the massive collection of evidence from varied fields as: comparative anatomy and behavior, molecular genetics, paleontology, population genetics, biogeography and so on. GG dismisses or avoids dealing with the evidence persistently as we will see shortly when she rejects the transitional evidence I presented for the transition between Dinosaurs and modern Birds. But this naked rejection of the evidence is too embarrassing, so she camouflages it with straw man arguments - i.e. attacking positions that scientists and evolution theory don't posit.

 

 

 

Originally posted by G G:

as they managed to sketch a whole pre-human and his family (complete with skin and hair - in colour) from 2 teeth. Which then unfortunately had to belong to a stopid pig. This wasn't of course forgery, this was a serious misunderstanding (I'm seriously not being sarcastic). If the teeth had been human, it would have made all the difference.

This is what I mean with GG's constant attack on irrelevant issues. Ask yourself this question: does any forgery or "misunderstanding" detract from the fact that modern humans evolved from ape-like ancestors? Does it, when we have a vast fossil record showing the gradual evolution of modern humans from earlier ape-like ancestors? Here is a list of fossil record regarding human evolution:

 

1. Australopithecus anamensis - lived 4.2 to 3.9 million years ago (mya).

2. Australopithecus afarensis - lived 3.9 to 3 mya

3. Australopithecus africanus - lived 3 to 2 mya

4. Australopithecus aethiopicus - lived 2.6 to 2.3 mya

5. Homo habilis - lived 2.4 to 1.5 mya

6. Homo erectus - lived 1.8 mya to 300,000

7. Homo sapiens - lived 500k to 200k years ago (ya)

8. Homo sapiens neanderthalensis - lived 230k to 30k ya

 

 

Now, in the face of such massive (note, I presented, for brevity, an incomplete fossil record here) fossil evidence, does any of GG's pathetic quibbles make any difference? Of course not. This is why GG keeps harping on tangential issues instead of dealing with the evidence.

 

But GG can redeem herself, she can now deal with the evidence I presented above and explain to us why she rejects human evolution from a common ape-like ancestor.

 

The flour is yours GG. Don't let the faithful down.

 

 

Originally posted by G G:

Wait, what evidence? (Btw I really don't like being called a creationist)

The evidence above (for human evolution) and the other evidence you ignored for the transition between between dinosaurs and birds.

 

 

Originally posted by G G:

I agree, evoscientists are as reliable as the writers of the Bible. Are they related??

Actually, the writers of the Bible have more in common with the writers of the Quran but that is for another debate. My point remains.

 

Scientists are humans and can deceive themselves and other scientists for various reasons. But it won't be long before they're exposed by none other than their peers. Science has the mechanism for self-correction. This is due to the adversarial nature of science.

 

Scientists always face uphill battle if they wanna convince other scientists about their discoveries. A scientist would first have to do real science work by collecting data, providing hypothesis and testable predictions and then testing those predictions. Once a scientist has his results, he must submit his paper to a peer-reviewed scientific journal. Most papers submitted to a peer-reviewed journals never get published but those that do get published are attacked by a whole slew of scientists who critically scrutinize any published papers. If the paper withstands those critical attacks, it lives to fight another day. If not, it is rejected. Even if it withstands those attacks, accepting the discovery would take many years.

 

So, you see the chances of any false finding being readily accepted by the scientific community is fleetingly small.

 

 

Originally posted by G G:

Muslims can't be slaves, soz bruv.

This is complete non sequitur as it doesn't logically follow from anything previously written. I didn't say anything about Muslim slaves. I said at the time when Darwin was fervent abolitionist, Muslims, especially arabs muslims were selling and buying black African slaves with alacrity.

 

 

Originally posted by G G:

I think I already asked you; please explain/clarify to me what evolutionary theory is. See, I even asked you nicely

Evolutionary Theory postulates that all currently living organisms evolved from one or few original living organisms. The theory gives several mechanisms for evolution including but not limited to Natural Selection, Genetic Drift, Gene Flow and so on.

 

Evolution impacts populations not individuals. Any one individual is irrelevant.

 

At the most basic level, evolution can be defined as the change in gene or allele frequency of a population over many generations.

 

 

Originally posted by G G:

Thanks! I agree with you, that

is

pretty cartoonish! Thank you for agreeing with me. Unfortunately that was actually what De Vries suggested in early 20th century.

And he was the developer of mutation theory of evolution. :'( That's why my knowledge of genetics is so cartoonish and naive. I blame him, it was the swieetie man. Fooking Dutch and his prawnmen!

This demonstrates to me that you're reading way too much Creationist claptrap. Creationists, because they can't refute the evidence, always engage in dishonest debating tactics. They'll misquote or take out of contexts what scientists say, they'll use long discredited ideas or rely on limited knowledge of scientists 100 years ago.

 

De Vries's Mutation Theory, which is NOT taught in schools (meaning you're reading this nonesense from Creationist websites), has long been discredited and we know have better knowledge about genetics.

 

If you wanna debate evolution, you gotta debate what evolution theory posits.

 

 

Originally posted by G G:

That's what evolutionists think.

Of course, that is what "evolutionists" think and that is what the evidence shows. Whose thinking should we mind? Creationists? People who believe the earth is only 6,000-10,000 years old and the reason dinosaurs are extinct is because they couldn't fit in Noah's Ark... should we be listening to them?

 

 

Originally posted by G G:

You know what, I actually googled that list in that exact order and guess what came up?

And why would you do that? Didn't you ask for evidence? If you were sincere in your request, the first think you should do should've been check out each species. This vindicates me in so many ways least of all that you guys, the Evolution Theory's detractors, aren't interested in honest debate. Nor are you interested in changing your views and accepting the fact of evolution. Your only interest is protecting your imaginary believes.

 

 

Originally posted by G G:

Now what did you say about copy&paste, you old hypocrite? Shame on you.

What a pathetic person you are. You asked for the transitional fossils between modern birds and their ancestors dinosaurs. I gave a list of those transitional fossils. And you accuse me of copy and pasting. You're a joke and charlatan.

 

Those fossils were DUG up by real scientists who classified them. No website owns them. They're physical reality outside of the internet. I don't copy and paste other people's ideas and then pass them off as my own. You're projecting.

 

Like I said earlier, you're too scared to deal with the evidence.

 

 

Originally posted by G G:

This is exactly what I mean with "confusing things". Australopithecus (both aferensis and africanus) is (supposedly) the forefather of modern chimpanzees. The fact that you say they resemble more humans than apes just sealed it for me.

It's official! You're a complete dolt. Before I thought you were a mere dilettante but your case is worse. How could you write Australopithecus was the ancestor of modern chimpazees and expect to be taken seriously?

 

For the record, Australopithecus is NOT the ancestor of modern chimpazees.

 

 

 

Originally posted by G G:

And this is your explanation? Because they came earlier, they must be their ancestors?

Are you doing this on purpose? You can't be this daft. Yes, the older the fossils, the more likely -- given everything else -- they're the ancestors of the younger fossils. Just like you're descendant of your great-grandfather who lived long time ago.

 

Originally posted by G G:

And by the way, how does one get the date of fossils?

Radiometric dating.

 

 

Originally posted by G G:

We don't all carry mutant genes, if we did we'd be facking retards. (No offense to those who have inherited diseases)

Mutation, along with Theory, means different thing to a scientists than to a layman. This is what I've been trying to tell you all along and it seems you have missed or ignored it completely. Mutations in genetics means mistakes in the genome arising from the copying process. It' is a mistake that happens all the time and contributes to the genetic diversity present in many organisms.

 

 

Originally posted by G G:

So a group of guys had a look at this bird that looked funny, and in their all-powerful wisdom, they declared it an intermediate? Yeah, sure, sounds good by me.

Another hit from our dear GG -- attacking imaginary position no one holds. Who ever said Archeopteryx looked funny, therefore it must be an intermediate? Who really holds such position?

 

 

Originally posted by G G:

Why genetic make up and mutation are not the same thing:

 

Mutations are changes in the DNA sequence of a cell's genome ...

I'll let the readers see what a nincompoop you are... the Wikipedia passage you provide disagrees with you and yet you're blissfully unaware.

 

Genome and genes are like apples and oranges to our hapless GG.

 

 

Originally posted by G G:

And where did they come from? Or have they always been, and we've solved the mystery of life, and these single celled organisms are the origin of all life, our forefathers?

These questions are irrelevant to Evolution Theory since the theory assumes the existence of one or few living organisms.

 

 

Originally posted by G G:

Life on Earth (material pursuits etc) is meaningless and ultimately an illusion. The test however is real. The realness of free will can be seen in our discussion: you don't believe in God, I do. Because God has created you so that you will never be able to predict tomorrow; knowing your future is impossible for you. Therefore free will is real for you and not for Him. Just like this world is the reality for you and not for Him.

I have hard time following what you're saying. What do you mean free will is not real for Him? Are you saying God doesn't have free will?

 

I'll respond more once you clarify what you wrote above.

 

Also, keep in mind that the free will we're debating is the one pertaining to your ultimate salvation. Not meaningless free will like what kind of car you drive or job you have. But whether you have the free will to affect your ultimate fate in the after life.

[Somali09]

Very well put Raamsaade.

 

"G.G" - you have an eager audience waiting for you to discuss the EVIDENCE, the whole evidence and nothing but the evidence!

[N.O.R.F]

Raamsade

 

Is that what you call 'evidence'? Have you ever critically evaluated this 'evidence'?

 

I for one would be very interested on how you would refute the following assessment by Harun Yahya in his book Evolution Deceit.

 

THE FOSSIL RECORD REFUTES EVOLUTION

 

THE EVER-MISSING LINKS

 

According to the theory of evolution, every living species has emerged from a predecessor. One species which existed previously turned into something else over time and all species have come into being in this way. According to the theory, this transformation proceeds gradually over millions of years.

 

If this were the case, then innumerable intermediate species should have lived during the immense period of time when these transformations were supposedly occurring. For instance, there should have lived in the past some half-fish/half-repti le creatures which had acquired some reptilian traits in addition to the fish traits they already had. Or there should have existed some reptile/bird creatures, which had acquired some avian traits in addition to the reptilian traits they already possessed. Evolutionists refer to these imaginary creatures, which they believe to have lived in the past, as "transitional forms".

 

If such animals had really existed, there would have been millions, even billions, of them. More importantly, the remains of these creatures should be present in the fossil record. The number of these transitional forms should have been even greater than that of present animal species, and their remains should be found all over the world. In The Origin of Species, Darwin accepted this fact and explained:

 

If my theory be true, numberless intermediate varieties, linking most closely all of the species of the same group together must assuredly have existed... Consequently evidence of their former existence could be found only amongst fossil remains.23

 

Even Darwin himself was aware of the absence of such transitional forms. He hoped that they would be found in the future. Despite his optimism, he realised that these missing intermediate forms were the biggest stumbling-block for his theory. That is why he wrote the following in the chapter of the The Origin of Species entitled "Difficulties of the Theory":

 

…Why, if species have descended from other species by fine gradations, do we not everywhere see innumerable transitional forms? Why is not all nature in confusion, instead of the species being, as we see them, well defined?… But, as by this theory innumerable transitional forms must have existed, why do we not find them embedded in countless numbers in the crust of the earth?… But in the intermediate region, having intermediate conditions of life, why do we not now find closely-linking intermediate varieties? This difficulty for a long time quite confounded me.24

 

The only explanation Darwin could come up with to counter this objection was the argument that the fossil record uncovered so far was inadequate. He asserted that when the fossil record had been studied in detail, the missing links would be found.

 

Believing in Darwin's prophecy, evolutionist paleontologists have been digging up fossils and searching for missing links all over the world since the middle of the 19th century. Despite their best efforts, no transitional forms have yet been uncovered. All the fossils unearthed in excavations have shown that, contrary to the beliefs of evolutionists, life appeared on earth all of a sudden and fully-formed. Trying to prove their theory, evolutionists have instead unwittingly caused it to collapse.

 

A famous British paleontologist, Derek V. Ager, admits this fact even though he is an evolutionist:

 

The point emerges that if we examine the fossil record in detail, whether at the level of orders or of species, we find-over and over again-not gradual evolution, but the sudden explosion of one group at the expense of another.25

 

Another evolutionist paleontologist Mark Czarnecki comments as follows:

 

A major problem in proving the theory has been the fossil record; the imprints of vanished species preserved in the Earth's geological formations. This record has never revealed traces of Darwin's hypothetical intermediate variants - instead species appear and disappear abruptly, and this anomaly has fueled the creationist argument that each species was created by God.26

 

These gaps in the fossil record cannot be explained by saying that sufficient fossils have not yet been found, but that they one day will be. Another American scholar, Robert Wesson, states in his 1991 book Beyond Natural Selection, that "the gaps in the fossil record are real and meaningful". He elaborates this claim in this way:

 

The gaps in the record are real, however. The absence of a record of any important branching is quite phenomenal. Species are usually static, or nearly so, for long periods, species seldom and genera never show evolution into new species or genera but replacement of one by another, and change is more or less abrupt.27

 

LIVING FOSSILS

 

A few fossilized creatures dating back millions of years, but which are no different to modern specimens. These remains are “living” proof that all living things emerged, not as the result of evolution, but by flawless creation, and that they never underwent evolution at all.

 

The living honeybee is no different than its fossil relative, which is millions of years old.

 

The 135 million year old dragon fly fossil is no different than its modern counterparts.

 

A comparison of a fossilized ant 100 million years old with a modern-day ant clearly indicates that these insects do not have any evolutionary history.

 

LIFE EMERGED ON EARTH SUDDENLY AND IN COMPLEX FORMS

 

When terrestrial strata and the fossil record are examined, it is to be seen that all living organisms appeared simultaneously. The oldest stratum of the earth in which fossils of living creatures have been found is that of the Cambrian, which has an estimated age of 500-550 million years.

 

The living creatures found in the strata belonging to the Cambrian period emerged all of a sudden in the fossil record-there are no pre-existing ancestors. The fossils found in Cambrian rocks belonged to snails, trilobites, sponges, earthworms, jellyfish, sea hedgehogs, and other complex invertebrates. This wide mosaic of living organisms made up of such a great number of complex creatures emerged so suddenly that this miraculous event is referred to as the "Cambrian Explosion" in geological literature.

 

Most of the creatures in this layer have complex systems have complex systems and advanced structures, such as eyes, gills, and circulatory systems, exactly the same as those in modern specimens. For instance, the double-lensed, combed eye structure of trilobites is a wonder of creation. David Raup, a professor of geology in Harvard, Rochester, and Chicago Universities, says: "the trilobites 450 million years ago used an optimal design which would require a well trained and imaginative optical engineer to develop today".28

 

These complex invertebrates emerged suddenly and completely without having any link or any transitional form between them and the unicellular organisms, which were the only life forms on earth prior to them.

 

The fossil record proves that transitional forms never existed, no evolution took place and all species have been created separately in a perfect form.

 

Richard Monastersky, a science journalist at Science News, one of the popular publications of evolutionist literature, states the following about the "Cambrian Explosion", which is a deathtrap for evolutionary theory:

A half-billion years ago, the remarkably complex forms of animals we see today suddenly appeared. This moment, right at the start of Earth's Cambrian Period, some 550 million years ago, marks the evolutionary explosion that filled the seas with the earth's first complex creatures. ...the large animal phyla of today were present already in the early Cambrian ...and they were as distinct from each other as they are today.29

 

Deeper investigation into the Cambrian Explosion shows what a great dilemma it creates for the theory of evolution. Recent findings indicate that almost all phyla, the most basic animal divisions, emerged abruptly in the Cambrian period. An article published in Science magazine in 2001 says: "The beginning of the Cambrian period, some 545 million years ago, saw the sudden appearance in the fossil record of almost all the main types of animals (phyla) that still dominate the biota today".30 The same article notes that for such complex and distinct living groups to be explained according to the theory of evolution, very rich fossil beds showing a gradual developmental process should have been found, but this has not yet proved possible:

 

 

This differential evolution and dispersal, too, must have required a previous history of the group for which there is no fossil record.31

 

How the earth came to overflow with such a great number of animal species all of a sudden, and how these distinct types of species with no common ancestors could have emerged, is a question that remains unanswered by evolutionists. The Oxford University zoologist Richard Dawkins, one of the foremost advocates of evolutionist thought in the world, comments on this reality that undermines the very foundation of all the arguments he has been defending:

 

For example the Cambrian strata of rocks... are the oldest ones in which we find most of the major invertebrate groups. And we find many of them already in an advanced state of evolution, the very first time they appear. It is as though they were just planted there, without any evolutionary history.32

 

THE EYE OF THE TRILOBITE

 

The trilobites that appeared in the Cambrian period all of a sudden have an extremely complex eye structure. Consisting of millions of honeycomb-shaped tiny particles and a double-lens system, this eye "has an optimal design which would require a well-trained and imaginative optical engineer to develop today" in the words of David Raup, a professor of geology.

 

This eye emerged 530 million years ago in a perfect state. No doubt, the sudden appearance of such a wondrous design cannot be explained by evolution and it proves the actuality of creation.

 

Moreover, the honeycomb eye structure of the trilobite has survived to our own day without a single change. Some insects such as bees and dragon flies have the same eye structure as did the trilobite.* This situation disproves the evolutionary thesis that living things evolved progressively from the primitive to the complex.

 

(*) R. L. Gregory, Eye and Brain: The Physiology of Seeing,

Oxford University Press, 1995, s. 31.

 

As Dawkins is forced to acknowledge, the Cambrian Explosion is strong evidence for creation, because creation is the only way to explain the fully-formed emergence of life on earth. Douglas Futuyma, a prominent evolutionist biologist admits this fact: "Organisms either appeared on the earth fully developed or they did not. If they did not, they must have developed from preüexisting species by some process of modification. If they did appear in a fully developed state, they must indeed have been created by some omnipotent intelligence." 33 Darwin himself recognised the possibility of this when he wrote: "If numerous species, belonging to the same genera or families, have really started into life all at once, the fact would be fatal to the theory of descent with slow modification through natural selection." 34 The Cambrian Period is nothing more or less than Darwin's "fatal stroke". This is why the Swiss evolutionist paleoanthropologist Stefan Bengtson, who confesses the lack of transitional links while describing the Cambrian Age, makes the following comment: "Baffling (and embarrasing) to Darwin, this event still dazzles us".35

 

Obviously, the fossil record indicates that living things did not evolve from primitive to the advanced forms, but instead emerged all of a sudden and in a perfect state. In short, living beings did not come into existence by evolution, they were created.

 

MOLECULAR COMPARISONS DEEPEN EVOLUTION'S CAMBRIAN IMPASSE

 

Another fact that puts evolutionists into a deep quandary about the Cambrian Explosion is the comparisons between different living taxa. The results of these comparisons reveal that animal taxa considered to be "close relatives" by evolutionists until quite recently, are genetically very different, which puts the "intermediate form" hypothesis, that only exists theoretically, into an even greater quandary. An article published in the Proceedings of the National Academy of Sciences in 2000 reports that DNA analyses have displaced taxa that used to be considered "intermediate forms" in the past:

 

DNA sequence analysis dictates new interpretation of phylogenic trees. Taxa that were once thought to represent successive grades of complexity at the base of the metazoan tree are being displaced to much higher positions inside the tree. This leaves no evolutionary "intermediates" and forces us to rethink the genesis of bilaterian complexity....36

 

In the same article, evolutionist writers note that some taxa which were considered "intermediate" between groups such as sponges, cnidarians and ctenophores can no longer be considered as such because of new genetic findings, and that they have "lost hope" of constructing such evolutionary family trees:

 

The new molecular based phylogeny has several important implications. Foremost among them is the disappearance of "intermediate" taxa between sponges, cnidarians, ctenophores, and the last common ancestor of bilaterians or "Urbilateria." ...A corollary is that we have a major gap in the stem leading to the Urbilataria. We have lost the hope, so common in older evolutionary reasoning, of reconstructing the morphology of the "coelomate ancestor" through a scenario involving successive grades of increasing complexity based on the anatomy of extant "primitive" lineages. 37

 

 

 

23 Charles Darwin, The Origin of Species: A Facsimile of the First Edition, Harvard University Press, 1964, p. 179.

24 Ibid, pp. 172, 280.

25 Derek V. Ager, "The Nature of the Fossil Record", Proceedings of the British Geological Association, Vol 87, 1976, p. 133.

26 Mark Czarnecki, "The Revival of the Creationist Crusade", MacLean's, January 19, 1981, p. 56.

27 R. Wesson, Beyond Natural Selection, MIT Press, Cambridge, MA, 1991, p. 45.

28 David Raup, "Conflicts Between Darwin and Paleontology", Bulletin, Field Museum of Natural History, Vol 50, January 1979, p. 24.

29 Richard Monastersky, "Mysteries of the Orient", Discover, April 1993, p. 40.

30 Richard Fortey, "The Cambrian Explosion Exploded?", Science, vol 293, No 5529, 20 July 2001, p. 438-439.

31 Ibid.

32 Richard Dawkins, The Blind Watchmaker, London: W. W. Norton 1986, p. 229.

33 Douglas J. Futuyma, Science on Trial, New York: Pantheon Books, 1983, p. 197.

34 Charles Darwin, The Origin of Species: A Facsimile of the First Edition, Harvard University Press, 1964, p. 302.

35 Stefan Bengston, Nature, Vol. 345, 1990, p. 765.

36 The New Animal Phylogeny: Reliability And Implications, Proc. of Nat. Aca. of Sci., 25 April 2000, vol 97, No 9, p. 4453-4456.

37 Ibid.

The floor is yours ladies and gents.

[Naden]

Northerner, I have to admit, I am in awe (and admiration!) of your tenacity. You are truly a soldier of God, unwavering to the end (no sarcasm intended at all). Please, though, distance yourself as far away as you can from Harun Yahya. Methinks even God may find his ignorance objectionable. For what it's worth, studying evolutionary theory and some of the evidence from different disciplines may be to your liking and may not offend your Muslim convictions.

 

Originally posted by Johnny B:

Obviously the thread cries for positive contribution, preferably something about God.

[/QB]

Johnny B, I think this thread is, indeed, in dire need of a discussion about God.

[N.O.R.F]

Naden,

 

Thanks. I try to have a discussion. After a false start or two I throw some meat into the ring for the all to fight over.

 

This isn't the first time you have stated your reservations on HY and his work. You haven't given any reasons for those reservations. Care to expand? I am also finding it difficult to find anyone refuting the contents of his book. Maybe our nomads can have go????

 

ps this thread in need of your full participation me thinks. I can't get anything out of Johnny's haphazard debating skills.

 

pps a new thread may be required as this one is leaning more towards the evolution/creation argument.

[Cara.]

^Yahya's arguments are almost verbatim Christian creationist propaganda, and those have been debunked by scientists many times. What I find troubling is the out-of-context quotes from "evolutionists" that Yahya and co like to present as supporting creationism. Eg, in the above article,

 

A famous British paleontologist, Derek V. Ager, admits this fact even though he is an evolutionist:

 

The point emerges that if we examine the fossil record in detail, whether at the level of orders or of species, we find-over and over again-not gradual evolution, but the sudden explosion of one group at the expense of another

.

Reading that, the average person thinks Ager is talking about a fossil record that shows one set of species on a Tuesday afternoon 4000 BC, and by Wednesday at 3 pm there was another set of species. But what the creationist deliberately ignores is that words like abrupt, sudden, explosion mean something entirely different to an evolutionist: eg, we expected this tiny insect to evolve wings over a span of 400 million years, but it "only" took 60 million years. The Cambrian explosion, for example occurred nearly 600 million years ago (long before any traces of dinosaurs or mammals much less humans), and over a period of a mere 80-100 million years, there was a sudden proliferation of tiny organisms that only a paleontologist could tell apart. To hear a creationist talk about the Cambrian explosion though, you would think the fossil record shows that all current living species appeared over a 6-day work week a couple of years before Noah loaded them all into a boat.